Upload Form
Upload File:
Description:	Query sequences uploaded on 2012-02-11
On Duplicated Accession IDs:	For faster upload speed. Do not check ID duplication. I am pretty sure the uploaded sequences are unique. Replace previous sequences in the database with new sequences in the uploaded file. Keep previous sequences in the database and skip the sequences in the uploaded file.
After Successful Upload:	Do nothing. Do automatic BLAST search.

Your query sequences must be saved in FASTA format, e.g.

>gi37594443 Homo sapiens zinc finger, MYND domain containing 10 (ZMYND10), mRNA
TTCCATGGCTGCGAGAACTGACGCTCCCCAACCGTCCCGCAACTGTCCTGTCCCAGACTTTGGCACCGTC
GGGGTCCGTCGTCCCCGAATGTGACAGCATCCCCACCCCGGCTGCTGCCCAGGATCCGCCGGACCCCGGC

Here is a FASTA file for system test purpose. (Right click on the link, then "Save Target As...")

Copyright © 2005 - 2007 Samuel Roberts Noble Foundation