Mtr.37235.1.S1_at  |
 |
Expression profile (Problem seeing the expression profile below? Get flash player.)
|
 Add to Multi-transcript Viewer (MTV) 
Customize slides (experiments / samples)
 View co-expressed transcripts
|
Consensus, target, and probe sequences: (
 How to interprete
) |
>Mtr.37235.1.S1_at
GTAGAAGATTCATGCCTGAGAAAGGATCCGTTGAGTATGATGAGCTTGCTAAGGACTACCAGAAGACTTATTTGAGGACAATCACCGCAAAGAATGATAC
CCTTACTAACTTGACCATCTTAGAGGTCTTGTCAAGGCATGCTTCTGATGAACAATACCTTGGAGAGAGAATTGAAGGTGATCTCTGGACTTCTGATTCA
CAACCAAAACAGGCCTACAAGAAGTTTGGAAAGAAGTTGGCTGAAATCGAGAAAAACCTCATTCAAAGGAACAATGATGAGACACTGAGGAATCGAAATG
GACCTGTGAAGATGCCATATACACTGCTTTATCCTACTAGTGAGGAAGGATTGACTTCCAGAGGCATTCCCAACAGTGTCTCCATCTAAAAAATGTCATC
GTCGTTGTTGTGTTGTTGCTTTAAATAATCGATGAGAAGGAATCCAATTCCCTCACCTCCCTATGTATGGTCATGTTGTGTTATTATGTATGTTTGATTG
ATTTCTATAAAAACTACTATGTTTGTTGTGTGATGGACTTACTATATCAAATTCAAATGCAAGCTTCATATTT
Chip and genome coordinates:
| Probe ID | Probe Sequence | Chip X | Chip Y | Interrogation Position | Target Strand |
| Mtr.37235.1.S1_at:475:487 | GCCTGAGAAAGGATCCGTTGAGTAT | 475 | 487 | 26 | Antisense
|
| Mtr.37235.1.S1_at:632:1011 | TCACCGCAAAGAATGATACCCTTAC | 632 | 1011 | 94 | Antisense
|
| Mtr.37235.1.S1_at:244:45 | ATACCCTTACTAACTTGACCATCTT | 244 | 45 | 109 | Antisense
|
| Mtr.37235.1.S1_at:314:1021 | TCACAACCAAAACAGGCCTACAAGA | 314 | 1021 | 210 | Antisense
|
| Mtr.37235.1.S1_at:870:713 | GTTGGCTGAAATCGAGAAAAACCTC | 870 | 713 | 248 | Antisense
|
| Mtr.37235.1.S1_at:725:985 | TCGAAATGGACCTGTGAAGATGCCA | 725 | 985 | 305 | Antisense
|
| Mtr.37235.1.S1_at:343:411 | CATATACACTGCTTTATCCTACTAG | 343 | 411 | 328 | Antisense
|
| Mtr.37235.1.S1_at:456:979 | TCCATCTAAAAAATGTCATCGTCGT | 456 | 979 | 393 | Antisense
|
| Mtr.37235.1.S1_at:831:641 | GAGAAGGAATCCAATTCCCTCACCT | 831 | 641 | 446 | Antisense
|
| Mtr.37235.1.S1_at:554:1019 | TCACCTCCCTATGTATGGTCATGTT | 554 | 1019 | 465 | Antisense
|
| Mtr.37235.1.S1_at:589:749 | GTTTGTTGTGTGATGGACTTACTAT | 589 | 749 | 533 | Antisense
|
 View probes mapped to the Mt genome |
|
| Initial annotation during chip design |
"TC100188 /FEA=mRNA /DEF=similar to UP|Q43817 (Q43817) Lipoxygenase , partial (15%)"
Representative public ID: TC100188
|
| Gene (re)mapping & annotations |
Probe-based mapping to MTGI v8 and IMGAG v2 genes (
Strategy
)
| Gene ID | Description |
| TC100188 |
similar to UP|Q43817 (Q43817) Lipoxygenase , partial (15%) |
|
| Legume specific gene |
| Based on BLAST searches, this transcript is not legume specific. |
| Homolog transcripts |
| Species | Probeset ID | Transcript Description | E-Value | Bit Score |
| Glycine max |
Gma.1862.1.S1_at |
Glyma13g42310.1 |
6e-42 |
116 |
| Glycine max |
GmaAffx.20925.1.S1_at |
Glyma10g29490.1; Glyma10g29490.2; Glyma20g37810.1 |
3e-41 |
118 |
| Glycine max |
GmaAffx.89826.1.S1_at |
Glyma04g11870.1; Glyma13g42330.1 |
3e-37 |
151 |
| Glycine max |
GmaAffx.24359.1.A1_at |
Glyma08g20190.1 |
3e-34 |
105 |
| Glycine max |
Gma.10969.3.S1_x_at |
Glyma15g03040.1; Glyma15g03040.2; Glyma15g03040.3 |
3e-33 |
131 |
| Lotus japonicus |
chr3.CM0115.59_at |
chr3.CM0115.330.nc |
5e-50 |
194 |
| Lotus japonicus |
chr3.TM0576.3_at |
chr3.LjT02L14.10.nd |
5e-41 |
100 |
| Lotus japonicus |
chr3.CM0115.67_at |
chr3.CM0115.370.nc |
1e-38 |
156 |
| Lotus japonicus |
chr3.CM0115.46_at |
chr3.CM0115.240.nc |
2e-36 |
86.3 |
| Lotus japonicus |
chr3.TM0576.21_s_at |
chr3.LjT02L14.170.nd |
1e-34 |
87.2 |
|
GO annotations  |
| Go Term | Go Name | Evidence |
| GO:0016165 |
lipoxygenase activity |
Deborah Samac (2009): BLAST TC128724 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G55020.1, e-value 1.00E-39.
|
| GO:0048364 |
root development |
Deborah Samac (2009): BLAST TC128724 (evalue 0) against TAIR Arabidopsis genes. Top hit AT1G55020.1, e-value 1.00E-39.
|
|
| Protein domains |
| No information available |
| KEGG annotations based on the GeneBins database |
| Bincode | Name | Evidence |
| 99.1.1.35 |
KO:K00454 |
KEGG: Homolog to ath:At1g55020 (4e-35): F14C21.54; lipoxygenase (LOX1) [EC:1.13.11.12] [KO:K00454]||Swiss-Prot: Homolog to LOX1_LENCU (9e-57): Dioxygenase; Fattyacidbiosynthesis; Iron; Lipidsynthesis; Metal-binding; Multigenefamily; Oxidoreductase; Oxylipinbiosynthesis,Lipoxygenase (EC 1.13.11.12).||Gene Ontology: Homolog to GO_ID:21861 (1e-35): TAIR|gene:2011029 SPTR:Q06327 symbol:AT1G55020 [GO:0006952 "defense response" evidence=TAS] [GO:0009611 "response to wounding" evidence=TAS] [GO:0009695 "jasmonic acid biosynthesis" evidence=TAS] [GO:0009737 "response to abscisic acid stimulus" evidence=IEP] [GO:0009753 "response to jasmonic acid stimulus" evidence=IEP] [GO:0009816 "defense response to pathogenic bacteria, incompatible interaction" evidence=IEP] [GO:0016165 "lipoxygenase activity" evidence=IMP] [GO:0030397 "membrane disassembly" evidence=TAS] [GO:0040007 "growth" evidence=TAS] InterPro:IPR001246 InterPro:IPR000907 InterPro:IPR001024 InterPro:IPR008976 Pfam:PF00305 Pfam:PF01477 PRINTS:PR00087 PROSITE:PS00711 PROSITE:PS00081 PROSITE:PS50095 SMART:SM00308 HSSP:P08170 PRINTS:PR00468 EMBL:AC069144 EMBL:L04637 EMBL:U01843 EMBL:AY093104 EMBL:BT010358 PIR:JQ2267 SPTR:Q06327 |
| 99.1.3.1.129 |
EC 1.13.11.12 |
KEGG: Homolog to ath:At1g55020 (4e-35): F14C21.54; lipoxygenase (LOX1) [EC:1.13.11.12] [KO:K00454]||Swiss-Prot: Homolog to LOX1_LENCU (9e-57): Dioxygenase; Fattyacidbiosynthesis; Iron; Lipidsynthesis; Metal-binding; Multigenefamily; Oxidoreductase; Oxylipinbiosynthesis,Lipoxygenase (EC 1.13.11.12).||Gene Ontology: Homolog to GO_ID:21861 (1e-35): TAIR|gene:2011029 SPTR:Q06327 symbol:AT1G55020 [GO:0006952 "defense response" evidence=TAS] [GO:0009611 "response to wounding" evidence=TAS] [GO:0009695 "jasmonic acid biosynthesis" evidence=TAS] [GO:0009737 "response to abscisic acid stimulus" evidence=IEP] [GO:0009753 "response to jasmonic acid stimulus" evidence=IEP] [GO:0009816 "defense response to pathogenic bacteria, incompatible interaction" evidence=IEP] [GO:0016165 "lipoxygenase activity" evidence=IMP] [GO:0030397 "membrane disassembly" evidence=TAS] [GO:0040007 "growth" evidence=TAS] InterPro:IPR001246 InterPro:IPR000907 InterPro:IPR001024 InterPro:IPR008976 Pfam:PF00305 Pfam:PF01477 PRINTS:PR00087 PROSITE:PS00711 PROSITE:PS00081 PROSITE:PS50095 SMART:SM00308 HSSP:P08170 PRINTS:PR00468 EMBL:AC069144 EMBL:L04637 EMBL:U01843 EMBL:AY093104 EMBL:BT010358 PIR:JQ2267 SPTR:Q06327 |
| 99.1.4.3671 |
GO_ID:21861 |
KEGG: Homolog to ath:At1g55020 (4e-35): F14C21.54; lipoxygenase (LOX1) [EC:1.13.11.12] [KO:K00454]||Swiss-Prot: Homolog to LOX1_LENCU (9e-57): Dioxygenase; Fattyacidbiosynthesis; Iron; Lipidsynthesis; Metal-binding; Multigenefamily; Oxidoreductase; Oxylipinbiosynthesis,Lipoxygenase (EC 1.13.11.12).||Gene Ontology: Homolog to GO_ID:21861 (1e-35): TAIR|gene:2011029 SPTR:Q06327 symbol:AT1G55020 [GO:0006952 "defense response" evidence=TAS] [GO:0009611 "response to wounding" evidence=TAS] [GO:0009695 "jasmonic acid biosynthesis" evidence=TAS] [GO:0009737 "response to abscisic acid stimulus" evidence=IEP] [GO:0009753 "response to jasmonic acid stimulus" evidence=IEP] [GO:0009816 "defense response to pathogenic bacteria, incompatible interaction" evidence=IEP] [GO:0016165 "lipoxygenase activity" evidence=IMP] [GO:0030397 "membrane disassembly" evidence=TAS] [GO:0040007 "growth" evidence=TAS] InterPro:IPR001246 InterPro:IPR000907 InterPro:IPR001024 InterPro:IPR008976 Pfam:PF00305 Pfam:PF01477 PRINTS:PR00087 PROSITE:PS00711 PROSITE:PS00081 PROSITE:PS50095 SMART:SM00308 HSSP:P08170 PRINTS:PR00468 EMBL:AC069144 EMBL:L04637 EMBL:U01843 EMBL:AY093104 EMBL:BT010358 PIR:JQ2267 SPTR:Q06327 |
|
| Biological pathways |
| Based on the MedicCyc database , this transcript is involved in at least one biological pathways. To see details, click here and in the search box, input Mtr.37235.1.S1_at. |
| Transcription factor prediction and categorization |
| No information available (not predicted as a transcription factor) |
| Membrane transporter prediction and categorization |
| No information available (not predicted as a transcription factor) |
